Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 999703
End position: 999726
Length: 24

DNA sequence
>NC_005296, from 999703 to 999726 (24 bp); Rhodopseudomonas palustris CGA009 GTCGTCGTCATCCTCGTCGTCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 998750-1000444	Sequence	RPA0897 - hypothetical protein (Protein is coded in complementary strand; from 1000444 to 998750)