Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 986187
End position: 986210
Length: 24

DNA sequence
>NC_005296, from 986187 to 986210 (24 bp); Rhodopseudomonas palustris CGA009 TCGACGTCGACCTCGAAGTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 985554-986600	Sequence	RPA0888 - alpha/beta hydrolase (Protein is coded in complementary strand; from 986600 to 985554)