Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 539392
End position: 539416
Length: 25

DNA sequence
>NC_005296, from 539392 to 539416 (25 bp); Rhodopseudomonas palustris CGA009 TCGGCCTCGGCTTCCGCCTCGGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 539338-540000	Sequence	RPA0488 - CarD-like transcriptional regulator (Protein is coded in complementary strand; from 540000 to 539338)