Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 5217788
End position: 5217811
Length: 24

DNA sequence
>NC_005296, from 5217788 to 5217811 (24 bp); Rhodopseudomonas palustris CGA009 GAACAGGATCAGGACCAGGATCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5216625-5218511	Sequence	RPA4635 feoB ferrous iron transport protein B (Protein is coded in complementary strand; from 5218511 to 5216625)