Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 5168292
End position: 5168318
Length: 27

DNA sequence
>NC_005296, from 5168292 to 5168318 (27 bp); Rhodopseudomonas palustris CGA009 CGGCCGGGTCGGCCGGGTCGGCGGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5167429-5169585	Sequence	RPA4585 - lipopolysaccharide biosynthesis protein (Protein is coded in complementary strand; from 5169585 to 5167429)