Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 4930494
End position: 4930517
Length: 24

DNA sequence
>NC_005296, from 4930494 to 4930517 (24 bp); Rhodopseudomonas palustris CGA009 TCCTCGTACTCGACCTCGGCCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4928148-4931165	Sequence	RPA4377 ileS isoleucyl-tRNA synthetase (Protein is coded in complementary strand; from 4931165 to 4928148)