Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 4819539
End position: 4819562
Length: 24

DNA sequence
>NC_005296, from 4819539 to 4819562 (24 bp); Rhodopseudomonas palustris CGA009 GCCTCGGCGTCGGCCGCGGTCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4819047-4820009	Sequence	RPA4271 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (Protein is coded in complementary strand; from 4820009 to 4819047)