Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 4704880
End position: 4704903
Length: 24

DNA sequence
>NC_005296, from 4704880 to 4704903 (24 bp); Rhodopseudomonas palustris CGA009 CAGCGCCAGCGCCCGCGCCAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4704230-4705372	Sequence	RPA4160 - spermidine/putrescine ABC transporter ATP-binding subunit (Protein is coded in complementary strand; from 4705372 to 4704230)