Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 4563341
End position: 4563364
Length: 24

DNA sequence
>NC_005296, from 4563341 to 4563364 (24 bp); Rhodopseudomonas palustris CGA009 CCGGCGGCGGCGCCAGCGTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4563239-4564471	Sequence	RPA4034 - ABC transporter periplasmic branched chain amino acid binding protein