Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 4000939
End position: 4000962
Length: 24

DNA sequence
>NC_005296, from 4000939 to 4000962 (24 bp); Rhodopseudomonas palustris CGA009 AGCGCCATCGCCAGCGTCAGCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4000111-4001865	Sequence	RPA3536 - peptidoglycan glycosyltransferase (Protein is coded in complementary strand; from 4001865 to 4000111)