Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 3982770
End position: 3982794
Length: 25

DNA sequence
>NC_005296, from 3982770 to 3982794 (25 bp); Rhodopseudomonas palustris CGA009 CGGCGCCGGTGCCGGTGCCGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3981341-3983119	Sequence	RPA3522 ftsZ cell division protein FtsZ (Protein is coded in complementary strand; from 3983119 to 3981341)