Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 3808944
End position: 3808969
Length: 26

DNA sequence
>NC_005296, from 3808944 to 3808969 (26 bp); Rhodopseudomonas palustris CGA009 CGGCGGCGCCGGCTGCGGCGGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3808864-3809337	Sequence	RPA3366 - hypothetical protein (Protein is coded in complementary strand; from 3809337 to 3808864)