Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 3674051
End position: 3674080
Length: 30

DNA sequence
>NC_005296, from 3674051 to 3674080 (30 bp); Rhodopseudomonas palustris CGA009 TCGTCGTCATCGTCGTCATCATCGTCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3674048-3676186	Sequence	RPA3265 - ABC transporter (Protein is coded in complementary strand; from 3676186 to 3674048)