Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 3519683
End position: 3519706
Length: 24

DNA sequence
>NC_005296, from 3519683 to 3519706 (24 bp); Rhodopseudomonas palustris CGA009 ATGCCCATGCCGATGCTCATGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3518600-3520285	Sequence	RPA3115 - acyl-CoA dehydrogenase (Protein is coded in complementary strand; from 3520285 to 3518600)