Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 3485701
End position: 3485760
Length: 60

DNA sequence
>NC_005296, from 3485701 to 3485760 (60 bp); Rhodopseudomonas palustris CGA009 GGGCGCTTCAGGCTTGGCAGCTTCAGGCTTGGCAGCTTCCGGCTTGGCCGCTTCGGGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3485351-3486322	Sequence	RPA3081 - hypothetical protein (Protein is coded in complementary strand; from 3486322 to 3485351)