Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 3303583
End position: 3303607
Length: 25

DNA sequence
>NC_005296, from 3303583 to 3303607 (25 bp); Rhodopseudomonas palustris CGA009 GGCGGCGCCGGCGGCCGCGGCGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3303514-3306003	Sequence	RPA2923 - hypothetical protein (Protein is coded in complementary strand; from 3306003 to 3303514)