Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 3243730
End position: 3243754
Length: 25

DNA sequence
>NC_005296, from 3243730 to 3243754 (25 bp); Rhodopseudomonas palustris CGA009 GCCGGCGCCGACGCCGACGCCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3242963-3244372	Sequence	RPA2866 - pyruvate dehydrogenase subunit beta (Protein is coded in complementary strand; from 3244372 to 3242963)