Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 3222109
End position: 3222133
Length: 25

DNA sequence
>NC_005296, from 3222109 to 3222133 (25 bp); Rhodopseudomonas palustris CGA009 GCTGGCGTTGGCGCTAGCGCTAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3222083-3222898	Sequence	RPA2847 tatC Sec-independent protein translocase TatC (Protein is coded in complementary strand; from 3222898 to 3222083)