Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 3219566
End position: 3219610
Length: 45

DNA sequence
>NC_005296, from 3219566 to 3219610 (45 bp); Rhodopseudomonas palustris CGA009 ACGCTGCACCGACTTCGGCTGAACCGACTTGGGCTGAACCGACTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3219531-3220202	Sequence	RPA2844 - SCP-like extracellular protein (Protein is coded in complementary strand; from 3220202 to 3219531)