Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 3036141
End position: 3036164
Length: 24

DNA sequence
>NC_005296, from 3036141 to 3036164 (24 bp); Rhodopseudomonas palustris CGA009 CCGGTCGCCGATCGCTGGTCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3033100-3036618	Sequence	RPA2663 Mfd transcription-repair coupling factor