Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 2933425
End position: 2933471
Length: 47

DNA sequence
>NC_005296, from 2933425 to 2933471 (47 bp); Rhodopseudomonas palustris CGA009 CGCGATCCTGGTACCCTCGGTTCTGGTACCCGCGGTCCTGATAGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2933211-2933600	Sequence	RPA2579 - hypothetical protein (Protein is coded in complementary strand; from 2933600 to 2933211)