Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 2816225
End position: 2816255
Length: 31

DNA sequence
>NC_005296, from 2816225 to 2816255 (31 bp); Rhodopseudomonas palustris CGA009 GCCGGTGCGGCCGGCGCGGCCGGTGCGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2815836-2817254	Sequence	RPA2477 - ATP-dependent RNA helicase (Protein is coded in complementary strand; from 2817254 to 2815836)