Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 2791315
End position: 2791359
Length: 45

DNA sequence
>NC_005296, from 2791315 to 2791359 (45 bp); Rhodopseudomonas palustris CGA009 GTCTTGGCTGCGGGCGTCTTTGCAGCGGGTGACTTGGCGGCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2790796-2791485	Sequence	RPA2456 - bacterioferritin co-migratory protein (Protein is coded in complementary strand; from 2791485 to 2790796)