Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 2781429
End position: 2781453
Length: 25

DNA sequence
>NC_005296, from 2781429 to 2781453 (25 bp); Rhodopseudomonas palustris CGA009 CTTCCTCTTCGTCATCCTCTTCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2779169-2782324	Sequence	RPA2450 rne ribonuclease Rne/Rng family (Protein is coded in complementary strand; from 2782324 to 2779169)