Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 238915
End position: 238963
Length: 49

DNA sequence
>NC_005296, from 238915 to 238963 (49 bp); Rhodopseudomonas palustris CGA009 GCGGCTGACCGGGCTGCGGCGGAACCGGCTGCGGTTGGCCGGGCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 237864-239933	Sequence	RPA0213 - OmpA family protein (Protein is coded in complementary strand; from 239933 to 237864)