Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 2015921
End position: 2015945
Length: 25

DNA sequence
>NC_005296, from 2015921 to 2015945 (25 bp); Rhodopseudomonas palustris CGA009 GCCGGCGCCGCCGTCGGCGCCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2015733-2017013	Sequence	RPA1797 - hypothetical protein (Protein is coded in complementary strand; from 2017013 to 2015733)