Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 1876954
End position: 1876982
Length: 29

DNA sequence
>NC_005296, from 1876954 to 1876982 (29 bp); Rhodopseudomonas palustris CGA009 GGCGGCGCCGGCGGCGCTGGCGGTGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1876349-1880449	Sequence	RPA1685 - serine protease/outer membrane autotransporter