Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 1494851
End position: 1494874
Length: 24

DNA sequence
>NC_005296, from 1494851 to 1494874 (24 bp); Rhodopseudomonas palustris CGA009 TCGACGTCGACCTCAACGTCGAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1494203-1495957	Sequence	RPA1349 - hemolysin activation/secretion protein