Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 1394710
End position: 1394740
Length: 31

DNA sequence
>NC_005296, from 1394710 to 1394740 (31 bp); Rhodopseudomonas palustris CGA009 GCCGAACCAGGCCGAACGCGGCCAAATCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1394619-1395500	Sequence	RPA1274 - Dps protein family starvation-inducible DNA-binding protein