Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 1256309
End position: 1256334
Length: 26

DNA sequence
>NC_005296, from 1256309 to 1256334 (26 bp); Rhodopseudomonas palustris CGA009 GCGCACCGCAGCGCGCCGCAGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1255743-1256786	Sequence	RPA1148 - family 2 glycosyl transferase (Protein is coded in complementary strand; from 1256786 to 1255743)