Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 1247858
End position: 1247884
Length: 27

DNA sequence
>NC_005296, from 1247858 to 1247884 (27 bp); Rhodopseudomonas palustris CGA009 GCCCATGCCGCCCATACCGCCCATGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1247853-1249496	Sequence	RPA1140 groEL molecular chaperone GroEL (Protein is coded in complementary strand; from 1249496 to 1247853)