Sequence retrieval

Genome: Rhodopseudomonas palustris CGA009
Start position: 1161298
End position: 1161321
Length: 24

DNA sequence
>NC_005296, from 1161298 to 1161321 (24 bp); Rhodopseudomonas palustris CGA009 TCGACCTCGATCTCGATCTTGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1161049-1161924	Sequence	RPA1053 nadC nicotinate-nucleotide pyrophosphorylase (Protein is coded in complementary strand; from 1161924 to 1161049)