Sequence retrieval

Genome: Nanoarchaeum equitans
Start position: 314929
End position: 314958
Length: 30

DNA sequence
>NC_005213, from 314929 to 314958 (30 bp); Nanoarchaeum equitans ATAATCTTTTATACTCTTCTATAACCTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 314673-315971	Sequence	NEQ360 - hypothetical protein (Protein is coded in complementary strand; from 315971 to 314673)