Sequence retrieval

Genome: Nanoarchaeum equitans
Start position: 271721
End position: 271747
Length: 27

DNA sequence
>NC_005213, from 271721 to 271747 (27 bp); Nanoarchaeum equitans TTTTTGTATTTCTTGTATTTTATGTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 270507-272231	Sequence	NEQ299 - putative ATPase RIL (Protein is coded in complementary strand; from 272231 to 270507)