Sequence retrieval

Genome: Nanoarchaeum equitans
Start position: 238949
End position: 238985
Length: 37

DNA sequence
>NC_005213, from 238949 to 238985 (37 bp); Nanoarchaeum equitans TCATTAATAATTTCATTAACAATATCATTAACAACTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 234473-241066	Sequence	NEQ265 - hypothetical protein (Protein is coded in complementary strand; from 241066 to 234473)