Sequence retrieval

Genome: Nanoarchaeum equitans
Start position: 149256
End position: 149280
Length: 25

DNA sequence
>NC_005213, from 149256 to 149280 (25 bp); Nanoarchaeum equitans TCTTCTTCCTCTTCTACTTCTTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 149202-149369	Sequence	NEQ161 - hypothetical protein (Protein is coded in complementary strand; from 149369 to 149202)