Sequence retrieval

Genome: Vibrio vulnificus YJ016
Start position: 543768
End position: 543798
Length: 31

DNA sequence
>NC_005139, from 543768 to 543798 (31 bp); Vibrio vulnificus YJ016 CATCTTCGTCTTCATCTTCGTCTTCATCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 542525-544456	Sequence	VV0561 - RNA polymerase sigma factor RpoD (Protein is coded in complementary strand; from 544456 to 542525)