Sequence retrieval

Genome: Vibrio vulnificus YJ016
Start position: 3186824
End position: 3186850
Length: 27

DNA sequence
>NC_005139, from 3186824 to 3186850 (27 bp); Vibrio vulnificus YJ016 CCACCCATACCGCCCATACCACCCATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3186809-3188449	Sequence	VV3106 groEL chaperonin GroEL (Protein is coded in complementary strand; from 3188449 to 3186809)