Sequence retrieval

Genome: Vibrio vulnificus YJ016
Start position: 3140751
End position: 3140775
Length: 25

DNA sequence
>NC_005139, from 3140751 to 3140775 (25 bp); Vibrio vulnificus YJ016 TTCGCTTTGGCTTTCTCTTTCGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3140577-3143036	Sequence	VV3061 - exoribonuclease R (Protein is coded in complementary strand; from 3143036 to 3140577)