Sequence retrieval

Genome: Vibrio vulnificus YJ016
Start position: 2366310
End position: 2366333
Length: 24

DNA sequence
>NC_005139, from 2366310 to 2366333 (24 bp); Vibrio vulnificus YJ016 CACCACCGCCACCGCCACCACCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2364935-2366404	Sequence	VV2340 - 54K polar flagellar sheath protein A (Protein is coded in complementary strand; from 2366404 to 2364935)