Sequence retrieval

Genome: Vibrio vulnificus YJ016
Start position: 2361194
End position: 2361217
Length: 24

DNA sequence
>NC_005139, from 2361194 to 2361217 (24 bp); Vibrio vulnificus YJ016 ACCACCGCCACCACTACCACCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2358549-2361338	Sequence	VV2335 - hypothetical protein (Protein is coded in complementary strand; from 2361338 to 2358549)