Sequence retrieval

Genome: Vibrio vulnificus YJ016
Start position: 2195401
End position: 2195430
Length: 30

DNA sequence
>NC_005139, from 2195401 to 2195430 (30 bp); Vibrio vulnificus YJ016 TCTTGAACGATCTTGACCCATTTTGAACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2195389-2195868	Sequence	VV2185 - hypothetical protein (Protein is coded in complementary strand; from 2195868 to 2195389)