Sequence retrieval

Genome: Vibrio vulnificus YJ016
Start position: 1392008
End position: 1392033
Length: 26

DNA sequence
>NC_005139, from 1392008 to 1392033 (26 bp); Vibrio vulnificus YJ016 TCATACTCATACTCATACTCATACTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1391779-1392030	Sequence	VV1368 - DNA-binding protein inhibitor Id-2-related protein (Protein is coded in complementary strand; from 1392030 to 1391779)