Sequence retrieval

Genome: Vibrio vulnificus YJ016
Start position: 1228249
End position: 1228272
Length: 24

DNA sequence
>NC_005139, from 1228249 to 1228272 (24 bp); Vibrio vulnificus YJ016 AGGGCAAGTGCAACGGCAAGTGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1227277-1228581	Sequence	VV1215 - proton/glutamate symporter (Protein is coded in complementary strand; from 1228581 to 1227277)