Sequence retrieval

Genome: Vibrio vulnificus YJ016
Start position: 1099732
End position: 1099776
Length: 45

DNA sequence
>NC_005139, from 1099732 to 1099776 (45 bp); Vibrio vulnificus YJ016 GGTGTTCCTACTATCGATTTTCCTGCTATCGGTTTCCCTACTATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1099558-1101066	Sequence	VV1096 - TRAP-type C4-dicarboxylate transport system, periplasmic component