Sequence retrieval

Genome: Vibrio vulnificus YJ016
Start position: 343154
End position: 343184
Length: 31

DNA sequence
>NC_005139, from 343154 to 343184 (31 bp); Vibrio vulnificus YJ016 TAGTACCAGTAGTACCAGTAGTACCAGTAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 343150-343440	Sequence	VV0336 - hypothetical protein (Protein is coded in complementary strand; from 343440 to 343150)