Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 3326149
End position: 3326211
Length: 63

DNA sequence
>NC_005126, from 3326149 to 3326211 (63 bp); Photorhabdus luminescens TTATCAAAACGTTTATCTATAGATTCAAAACGTTTATCCATAACATCGAAACGTTTATCTATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3326047-3326442	Sequence	plu2800 - hypothetical protein (Protein is coded in complementary strand; from 3326442 to 3326047)