Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 4179319
End position: 4179379
Length: 61

DNA sequence
>NC_005126, from 4179319 to 4179379 (61 bp); Photorhabdus luminescens TTTTCACCTTTCTCTTCACCTTTCTTTTCACCTTTCTTTTCACCTTTTTTTTCACCTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4179208-4180215	Sequence	plu3546 ISPlu15A ISNCY family transposase (Protein is coded in complementary strand; from 4180215 to 4179208)