Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 784390
End position: 784449
Length: 60

DNA sequence
>NC_005126, from 784390 to 784449 (60 bp); Photorhabdus luminescens GTAATTGCACTATATTTAATTGTACTACATTTAATTGTACTATATTTAATTGCACTATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 783366-784394	Sequence	plu0682 lpxD UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase