Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 4476858
End position: 4476917
Length: 60

DNA sequence
>NC_005126, from 4476858 to 4476917 (60 bp); Photorhabdus luminescens TACCTTCTTCTCGGCCTTCTTCTCGGCCTTCTTCTCGGCCTTCTTCTCGGCCTTCTTCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4476755-4477717	Sequence	plu3811 - hypothetical protein (Protein is coded in complementary strand; from 4477717 to 4476755)